Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: VLDL induces ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) mRNA abundance of Bip, Chop and Nqo1. mRNA levels are normalised to Aprt (n = 8–10, five independent C2C12 cultures were used). (b) BiP, phospho-eIF2α (Ser51), TRB3, CHOP and β-actin protein levels. (c), mRNA abundance of Il6, Mcp1, Tnfα, IκBα and Socs3. (d) IκBα, p65 and β-actin protein levels. (e) Phospho-STAT3 (Tyr705), SOCS3 and β-actin protein levels. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and were compared by Student’s t test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: VLDL reduces PGC-1α and AMPK levels and induces insulin resistance. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) Pgc1α, Pparα (Ppara), Pparβ/δ (Pparb/Ppard), Acox and Mcad mRNA levels (n = 8–10, five independent C2C12 cultures were used). (b) PGC-1α, NRF1, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (c) NQO1, NRF2 and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307), and β-actin protein levels. (e) Phospho-Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and compared by Student’s t test (a–d) or two-way ANOVA followed by Tukey post hoc test (e). **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ERK1/2 inhibition and knockdown prevents the effects of VLDL. (a) C2C12 myotubes (MT) and isolated skeletal muscles (SM) were in-cubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL (myotubes) or 500 μg/ml VLDL (muscle) and the protein levels of phospho-ERK1/2 (Thr202/Tyr204) were analysed. (b, c) C2C12 myotubes were incubated in the presence (black bars) or absence (control, white bars) of 300 μg/ml VLDL for 24 h; 10 μmol/l U0126 was added to control (light grey bars) or VLDL-treated (dark grey bars) myotubes and the mRNA abundance of Bip, Chop, Nqo1, Il6, Mcp1 and Tnfα (b) and Pgc1α, Pparα, Pparβ/δ, Acox and Mcad (c) was evaluated. (d, e) C2C12 cells were transfected with control siRNA or ERK1/2siRNA and incubated in the presence or absence of 300 μg/ml VLDL. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (d) and Pgc1α, Pparα, Acox and Mcad (e) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars VLDL + control siRNA; dark grey bars VLDL+ERK1/2 siRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a) or two-way ANOVA followed by Tukey post hoc test (b–e). *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs VLDL-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Inhibition, Knockdown, Isolation, Muscles, Control, Incubation, Transfection

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ApoCIII activates ERK1/2 and induces ER stress, inflammation and insulin resistance. C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) BiP, phospho-eIF2α (Ser51), TRB3 and β-actin protein levels. (c) mRNA abundance of Pgc1α, Pparα and Pparβ/δ. (d) PGC-1α, NRF1 and β-actin protein levels. (e) Autoradiograph of EMSA performed with a 32P-labelled PPAR nucleotide and crude nuclear protein extract (NE) from C2C12 myotubes. One main specific complex (Compl I) based on competition with a molar excess of unlabelled probe is shown. The supershift assay performed by incubating NE with an antibody (Ab) directed against PPARβ/δ shows a reduction in the band, whereas the band is unchanged by an unrelated antibody against Oct1. (f) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (g) Phosphorylated Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a–f) or two-way ANOVA followed by Tukey post hoc test (g). *p < 0.05, **p < 0.01 and***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control, Autoradiography

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ERK1/2 inhibition prevents the effects of apoCIII on ER stress and inflammation. (a–e) C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 10 μmol/l U0126 was added to control myotubes (light grey bars) or apoCIII-treated myotubes (dark grey bars). (a) mRNA abundance of Bip, Chop, Socs3, Il6, Mcp1 and Tnfα. (b) BiP, phospho-eIF2α (Ser51), phospho-ERK1/2 (Thr202/Tyr204) and β-actin protein levels. (c) IκBα, NRF2, phospho-STAT3 (Tyr705) and β-actin protein levels. (d) mRNA abundance of Pgc1α, Pparα, Pparβ/δ, Acox and Mcad. (e) PGC-1α, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (f, g) C2C12 myotubes were transfected with control or ERK1/2 siRNA and incubated in the presence or absence of 100 μg/ml apoCIII for 24 h. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (f) and Pgc-1α, Pparα, Pparβ/δ, Acox and Mcad (g) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars, apoCIII+ control siRNA; dark grey bars, apoCIII+ERK1/2 siRNA The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Inhibition, Incubation, Control, Transfection

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: TLR2 mediates the effects of apoCIII on ERK1/2, ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 50 μg/ml of IgG was added to apoCIII-treated myotubes (black bars) or 50 μg/ml of the neutralising antibody against TLR2 (TLR2NAb) was added to the control (light grey bars) or apoCIII-treated (dark grey bars) myotubes. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα. (c) BiP, phospho-eIF2α (Ser51), IκBα, and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (e) PGC-1α, NRF1 and β-actin protein levels. (f) mRNA abundance of Pgc1α, Pparα, Acox and Mcad mRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Mediators of Inflammation

Article Title: Elevation of IL-6 and IL-33 Levels in Serum Associated with Lung Fibrosis and Skeletal Muscle Wasting in a Bleomycin-Induced Lung Injury Mouse Model

doi: 10.1155/2019/7947596

Figure Lengend Snippet: IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Article Snippet: C2C12 mouse adherent myoblasts were obtained from BCRC (Bioresource Collection and Research Center, Hsinchu, Taiwan).

Techniques: Western Blot, Incubation, Recombinant, Software, Control

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 is required in C2C12 differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Knockdown, Expressing

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 ribonuclease activity is required in early phase of C2C12 differentiation. ( a ) Differentiation was induced in the presence or absence of IRE1 RNase inhibitor, STF-083010 (60 µM; black bars) or DMSO (gray bars) for various time intervals as indicated. ( b ) Identification of critical time period for inhibitory effect of IRE1 activity on C2C12 differentiation. Scale bar = 200 µm. ( c ) Fusion index of STF-083010- or DMSO-treated cells. Results are mean + SEM (three biological replicates). The different letters denote significant differences between groups at p < 0.05 by Tukey’s HSD test.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Activity Assay

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: XBP1 is required for C2C12 differentiation. ( a ) mRNA expression of Xbp1 and spliced Xbp1 were compared between XBP1-knockdown cells (XBP1-KD) and mock cells. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) XBP1-knockdown cells and mock cells were induced to differentiate until day 5. Cells were observed for immunofluorescent staining with anti-MHC antibody. Scale bar = 200 µm. ( c ) Fusion index of mock or XBP1-KD cells. Results are mean + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( d ) Cells were harvested on the indicated day. mRNA expression of each myogenic factor was analyzed by qPCR. Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Knockdown, Staining

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: CDK5 is a downstream target of IRE1-XBP1 in C2C12 cells. ( a ) mRNA expression of Xbp1 and Cdk5 during C2C12 differentiation. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) An illustration of the predicted mouse Cdk5 promoter region. The region upstream of the Cdk5 gene comprises three XBP1-binding domains including CCAAT at −544 bp, TGCCACGTGG at −597 bp, and CCACGT at −1112 bp from the transcription start site. ( c , d ) Chromatin immunoprecipitation assay using a C2C12 genomic sample. Input DNA = positive control. Rabbit IgG was used as negative control ChIP ( c ). ChIP assay was performed by quantitative PCR analysis ( d ). Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05. ( e ) XBP1-knockdown and mock cells were transfected with the vector containing the Cdk5 promoter construct ( p 1400) or an empty vector. Cdk5 promoter activity was assessed by luciferase assay. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Binding Assay, Chromatin Immunoprecipitation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction, Knockdown, Transfection, Plasmid Preparation, Construct, Activity Assay, Luciferase

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Myosin heavy chain (MyHC) expression in parental C2C12 cells and C2C12-derived cells permanently expressing Wnt4. Parental C2C12 cells (a, b, e, and f) and W4-08 cells (c, d, g, and h) were cultured for 2 days in proliferation medium containing 10% fetal bovine serum (a–d), or in differentiation medium containing 2% horse serum (e–h), and then immunohistochemically stained with anti-MyHC antibodies, followed by counterstaining with DAPI. Spontaneous expression of slow-type MyHC was evident in W4-08 cells in proliferation medium and intensified in differentiation medium, although the proliferation rates were greatly reduced compared to those of the parental C2C12 cells, as observed in the reduced number of nuclei (blue).

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Derivative Assay, Cell Culture, Staining

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Summary of expression array analysis for C2C12 differentiation and Wnt4 expression. Red and green colors show upregulated and downregulated expression, respectively, with differentiation medium and Wnt4 overexpression. 1477 and 1836 genes were upregulated and downregulated, respectively, in differentiation medium and Wnt4 overexpression at a twofold magnitude. Refer to original data in supplementary 1 for details.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Over Expression

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effect of BMP4 and noggin on the myogenic differentiation of C2C12 cells. (a–d) The recombinant proteins were added to the proliferation medium at final concentrations of 5 ng/mL BMP4 and/or 50 ng/mL noggin and cultured in proliferation medium for 3 days, followed by immunostaining with anti-troponin T antibodies (red) and anti-phosphohistone H3 (Ser10) antibodies (green). BMP4 addition inhibited myogenic differentiation in proliferation medium. The number of cells expressing phosphorylated histone H3 was increased by adding noggin but not BMP4. (a) Control; (b) noggin; (c) BMP4; (d) noggin + BMP4. (e–g) The ratios of phosphohistone H3 (e) and troponin T-positive cells (f) to the total cell number were estimated. The number of multinuclear cells expressing troponin T (g) was also estimated to determine the ratio of fused cells among the total cells. Mean + SD ( n = 3), * P < 0.05 versus control with Student's t -test.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Recombinant, Cell Culture, Immunostaining, Expressing

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effects of BMP4 and noggin on phospho-Smad1/5 expression with or without Wnt3a and Wnt4. (a–l) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for phospho-Smad1/5 was carried out for counting. (a–c) Control; (d–f) BMP4; (g–i) noggin; (j–l) BMP4 + noggin. (m) The ratio of the nuclear phospho-Smad1/5-positive cells to the total cell number was estimated in three independent experiments counted for 6 fields each (mean + SD, n = 18, * P < 0.05 with Student's t -test).

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Recombinant, Infection, Immunostaining

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effects of BMP4 and noggin on β-catenin localization with or without Wnt3a and Wnt4. (a–i) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for β-catenin was carried out for counting. (j) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a and eGFP , after pixel intensity analysis for immunohistochemical signals with BZ-II Analyzer, shown in abscissa for signal intensity and ordinate for frequency. Wnt3a intensified signals to a higher level. (k and l) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a , Wnt4, and eGFP , in the presence or absence of BMP4 and/or noggin. Immunostaining for β-catenin was analyzed by digitizing the signals with BZ-II Analyzer for comparison. Typical results are shown. (k) Without BMP4; (l) with BMP4.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Recombinant, Infection, Immunostaining, Expressing, Immunohistochemical staining

Journal: PLOS Pathogens

Article Title: Withaferin A inhibits Chikungunya virus nsP2 protease and shows antiviral activity in the cell culture and mouse model of virus infection

doi: 10.1371/journal.ppat.1012816

Figure Lengend Snippet: (A) ERMS cells were infected with CHIKV at 1 MOI. At 0 h pi, the cell culture medium was supplemented with WFA (1 μM) or the vehicle DMSO (control). The total RNA was isolated at different times pi to quantify the intracellular viral RNA levels by qRT-PCR. The relative levels of the CHIKV RNA are shown in the left panel, where the CHIKV RNA level at 6 h pi in the control was taken as 1. The culture supernatant from the CHIKV-infected cells was collected, and the virus titers determined by the plaque assay are shown in the right panel. (B) ERMS cells infected with CHIKV (1 MOI) were treated with different concentrations of WFA. The cells were processed at 6 h pi for the intracellular viral RNA quantitation by qRT-PCR and cell viability by the MTT assay. The line graph demonstrating the relative viral RNA levels and per cent cell viability at the indicated WFA concentrations is shown. The viral RNA levels and per cent cell viability were normalized to the respective vehicle-only controls. (C) HeLa, Huh7, or C2C12 cells were infected with CHIKV (MOI 1) in the presence of WFA or DMSO (vehicle control), and the total RNA was isolated at 6 h pi. The relative CHIKV RNA levels determined by qRT-PCR are presented where the level of CHIKV RNA in the control cells was taken as 1. The student’s t-test was used to calculate the p values; * p <0.05, ** p <0.01, *** p <0.001.

Article Snippet: The human embryonal rhabdomyosarcoma (ERMS) (RD-CCL-136-ATCC) and mouse myoblast C2C12 cells (C2C12-CRL-1722-ATCC) were obtained from the ATCC, USA.

Techniques: Infection, Cell Culture, Control, Isolation, Quantitative RT-PCR, Virus, Plaque Assay, Quantitation Assay, MTT Assay

Journal: Human Molecular Genetics

Article Title: Decreased WNT/β-catenin signalling contributes to the pathogenesis of dilated cardiomyopathy caused by mutations in the lamin a/C gene

doi: 10.1093/hmg/ddw389

Figure Lengend Snippet: Expression and localization of connexin 43 are under WNT/β-catenin signalling regulation in hearts from LmnaH222P/H222P mice and cultured C2C12 cells. (A) Representative immunoblots showing WNT-1, total β-catenin and connexin 43 expression in hearts from 20-week-old male wild type (WT) and LmnaH222P/H222P (H222P) mice untreated (-), treated with BIO or with DMSO. (B) Immunohistochemistry for connexin 43 labelling in hearts from H222P mice treated with BIO or with DMSO. Scale bar, 50 μm. (C) Representative immunoblot showing connexin 43 and active β-catenin expression in C2C12 cells treated with BIO to activate Wnt/β-catenin signalling, or IWP2 and LGK974 to inhibit Wnt/β-catenin signalling. Migrations of molecular mass standards in kilodaltons (kDa) are indicated between the blots.

Article Snippet: C2C12 mouse myoblasts (ATCC) were maintained in DMEM supplemented with 10% Fetal Bovine Serum.

Techniques: Expressing, Cell Culture, Western Blot, Immunohistochemistry

Journal: Cell Communication and Signaling : CCS

Article Title: miR-449a regulates insulin signalling by targeting the Notch ligand, Jag1 in skeletal muscle cells

doi: 10.1186/s12964-019-0394-7

Figure Lengend Snippet: miR-449a targets Jag1 by binding to its 3’UTR. a Differentiated C2C12 cells were transfected with either the scramble (Scr) or the miR-449a mimic (1–75 nM). On termination of incubation (48 h), cells were lysed and 40 μg protein was resolved on SDS-PAGE and subjected to Western blot analysis using anti-Jag1 antibody. Hsc70 was taken as the loading control. b Differentiated C2C12 cells were incubated with miR-449a mimic (10 nM) alone or together with its inhibitor (10 nM). Control cells were transfected with scramble (Scr). After 48 h, Jag1 protein levels were assessed by Western blot analysis and Hsc70 was taken as the loading control. c C2C12 cells incubated as in ( b ) were assessed for the transcript levels of Jag1 by qRT-PCR. 18S rRNA was used as the normalisation control. d C2C12 cells were transfected with either scramble (Scr) or the miR-449a inhibitor (10, 25 nM) and incubated for 48 h. Protein levels of Jag1 were evaluated by western blot analysis and Hsc70 was taken as loading control. e Human primary skeletal muscle cells were transfected with either the scramble (Scr) or the miR-449a mimic (10 nM) alone or with its inhibitor and western blot analysis was performed using anti-Jag1 antibody. HSC70 was used as the loading control. f C2C12 cells were plated in 12-well plates and transfected with the wild-type (WT) or the mutated (mut) Jag1 3′ UTR (100 ng) together with the miR-449a mimic (10 nM) and/or its inhibitor (10 nM). Control cells were transfected with the scramble (Scr). After 48 h, cells were lysed and luciferase activity was measured as described in the ‘Materials and methods’. Firefly luciferase values were normalised to the values of Renilla luciferase. g The protein expression of Jag1 was assessed in db/+ and db/db mice by western blot analysis. Briefly, 40 μg protein from skeletal muscle of db/+ and db/db mice were separated on SDS-PAGE, transferred to nitro-cellulose membranes and probed with anti-Jag1 antibody. Hsc70 was used as the loading control. Densitometric analysis is given along with the respective blots. All experiments were done at least thrice and values present are mean ± SEM. *** p < 0.001, ** p < 0.01, * p < 0.05

Article Snippet: C2C12 mouse myoblast cells were obtained from the National Centre for Cell Science (NCCS), Pune, India and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Life Technologies, CA, USA) along with 100 units/ml penicillin, 0.1 mg/ml streptomycin (GIBCO, NY, USA) in the presence of 1.5 g/L sodium bicarbonate at 37 °C and 5% CO 2 .

Techniques: Binding Assay, Transfection, Incubation, SDS Page, Western Blot, Control, Quantitative RT-PCR, Luciferase, Activity Assay, Expressing

Journal: Cell Communication and Signaling : CCS

Article Title: miR-449a regulates insulin signalling by targeting the Notch ligand, Jag1 in skeletal muscle cells

doi: 10.1186/s12964-019-0394-7

Figure Lengend Snippet: miR-449a binding to Jag1 inhibits Notch target genes and NICD levels. a Differentiated C2C12 cells were transfected with the miR-449a mimic (10 nM) in the absence or presence of its inhibitor (10 nM). After 48 h, cells were lysed and relative transcript levels of Notch target genes, Hes1 ( a ) and Hey1 ( b ) were quantified by qRT-PCR and normalised to 18S rRNA. Control cells were transfected with the scramble (Scr). c Differentiated C2C12 cells were grown on six-well plates and transfected with miR-449a (10 nM) alone or in the presence of its inhibitor (10 nM). After 48 h, cells were fixed in 4% formaldehyde and immunofluorescence was performed with anti-NICD antibody as described in ‘Materials and Methods’ ( d ) Human primary skeletal muscle cells were grown on chamber slides and transfected with either scramble (Scr) or miR-449a alone or with its inhibitor (10 nM). As in (c), immunofluorescence was performed and cells were visualised in fluorescence microscope. Incubations were repeated at least three times and values are presented as mean ± SEM. *** p < 0.001, * p < 0.05

Article Snippet: C2C12 mouse myoblast cells were obtained from the National Centre for Cell Science (NCCS), Pune, India and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Life Technologies, CA, USA) along with 100 units/ml penicillin, 0.1 mg/ml streptomycin (GIBCO, NY, USA) in the presence of 1.5 g/L sodium bicarbonate at 37 °C and 5% CO 2 .

Techniques: Binding Assay, Transfection, Quantitative RT-PCR, Control, Immunofluorescence, Fluorescence, Microscopy

Journal: Cell Communication and Signaling : CCS

Article Title: miR-449a regulates insulin signalling by targeting the Notch ligand, Jag1 in skeletal muscle cells

doi: 10.1186/s12964-019-0394-7

Figure Lengend Snippet: Overexpression of miR-449a and inhibition of Notch signalling promote insulin signalling. a Differentiated C2C12 cells were transfected with the miR-449a mimic (10 nM) alone or together with its inhibitor (10 nM). Control cells were transfected with the scramble (Scr). After 48 h, cells of all groups were treated with insulin (100 nM) for 20 min and on termination of incubation, they were lysed and probed for the levels of p-PI3K, PI3K ( a ), p-AKT, AKT ( b ) by western blot analysis. β-actin was used as loading control. c C2C12 cells were transfected with either the scramble or miR-449a alone or together with its inhibitor and after 48 h, were incubated in Kreb’s-Ringer bicarbonate buffer for 2 h. Cell were then pre-incubated with insulin (100 nM) for 15 min, followed by incubation with 2-NBDG (500 μM) in the presence of insulin (100 nM) for 1 h. On termination of incubation, fluorescence intensity of 2-NBDG was measured as described in ‘Materials and Methods’ section. d Differentiated C2C12 cells were incubated with the Notch inhibitor, DAPT (5,10 μM) for 24 h and the transcript levels of Notch target gene, Hes1 were quantified by qRT-PCR. Control cells were incubated in the presence of DMSO (C). 18S rRNA was used as loading control. In another experiment, cells were incubated as in ( d ) for 24 h and then incubated with insulin (100 nM) for 20 min and evaluated for the levels of p-PI3K, PI3K ( e ) and p-AKT,AKT ( f ). β-actin was used as the loading control. Densitometric analyses are given below the respective blots. All the experiments were done at least thrice and data presented as mean ± SEM. * p < 0.05, ** p < 0.01

Article Snippet: C2C12 mouse myoblast cells were obtained from the National Centre for Cell Science (NCCS), Pune, India and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Life Technologies, CA, USA) along with 100 units/ml penicillin, 0.1 mg/ml streptomycin (GIBCO, NY, USA) in the presence of 1.5 g/L sodium bicarbonate at 37 °C and 5% CO 2 .

Techniques: Over Expression, Inhibition, Transfection, Control, Incubation, Western Blot, Fluorescence, Quantitative RT-PCR

Journal: Translational Cancer Research

Article Title: Regulation of dynamin-related protein 1 (DRP1) levels modulates myoblast atrophy induced by C26 colon cancer-conditioned medium

doi: 10.21037/tcr-21-751

Figure Lengend Snippet: C26 CM induced myotube atrophy and activated DRP1 expression. (A) C2C12 myotubes visualized by a biologic microscopy at ×200 magnification and. (B) Analysis of myotubes’ mean diameters. (C) DRP1 protein levels of the HS/CM group by western blotting. Data were shown as mean ± SD. ***P<0.01. HS, myotube cultured in DMEM of 2% HS (horse serum); CM, myotube cultured in DMEM of 33% C26 CM (conditional medium); DRP1, dynamin-related protein 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Article Snippet: C26 BALB/c mouse colon adenocarcinoma cells and C2C12 C3H mouse myoblasts (CRL-2638 and CRL1772, respectively; American Type Culture Collection, Manassas, VA, USA) were obtained from Dr. Han (Zhongshan Hospital, Shanghai, China).

Techniques: Expressing, Microscopy, Western Blot, Cell Culture

Journal: Translational Cancer Research

Article Title: Regulation of dynamin-related protein 1 (DRP1) levels modulates myoblast atrophy induced by C26 colon cancer-conditioned medium

doi: 10.21037/tcr-21-751

Figure Lengend Snippet: Regulation of DRP1 levels modulates myotube wasting during C26 CM-induced muscle atrophy. (A) Fluorescence images of eGFP expression and. (B) DRP1 protein levels of KD/OE/Dc group. (C) C2C12 myotubes visualized by a biologic microscopy and. (D) Analysis of myotubes’ mean diameters of KD/OE/Dc group. Data were shown as mean ± SD. ***P<0.01 vs. control. eGFP, enhanced green fluorescent protein. HS, myotube cultured in DMEM of 2% HS (horse serum); CM, myotube cultured in DMEM of 33% C26 CM (conditional medium); Dc, myotube infected with control lentivirus in CM; OE, myotube infected with overexpressed lentivirus in CM; KD, myotube infected with knockdown lentivirus in CM; DRP1, dynamin-related protein 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Article Snippet: C26 BALB/c mouse colon adenocarcinoma cells and C2C12 C3H mouse myoblasts (CRL-2638 and CRL1772, respectively; American Type Culture Collection, Manassas, VA, USA) were obtained from Dr. Han (Zhongshan Hospital, Shanghai, China).

Techniques: Fluorescence, Expressing, Microscopy, Control, Cell Culture, Infection, Knockdown

Journal: Translational Cancer Research

Article Title: Regulation of dynamin-related protein 1 (DRP1) levels modulates myoblast atrophy induced by C26 colon cancer-conditioned medium

doi: 10.21037/tcr-21-751

Figure Lengend Snippet: Transcriptome analysis of C2C12 myotubes. (A) MA plot (M-values: log-intensity ratios/A-values: log-intensity averages) based on the mean value of gene expression and the fold change, red represents up-regulated genes and blue represents down-regulated genes. (B) Heatmap for clustering analysis of differential expressed genes, blue represents high-expressed genes and red represents low-expressed genes. (C) Scatter plot of enrichment KEGG pathways based on differential expressed genes, the most prominent 30 pathways were selected. Q-values are numbers transferred from adjusted Q-values by hypergeometric test. The green degree of enrichment represents the ratio: the differential expressed genes to the total annotation genes in this pathway. (D&E) Enrichment of KEGG pathway for ribosome and oxidative phosphorylation, red represents up-regulated genes, blue represents down-regulated genes. CM, myotube cultured in DMEM of 33% C26 conditional medium; Dc, myotube infected with control lentivirus in C26 conditional medium; KD, myotube infected with knockdown lentivirus in C26 conditional medium.

Article Snippet: C26 BALB/c mouse colon adenocarcinoma cells and C2C12 C3H mouse myoblasts (CRL-2638 and CRL1772, respectively; American Type Culture Collection, Manassas, VA, USA) were obtained from Dr. Han (Zhongshan Hospital, Shanghai, China).

Techniques: Gene Expression, Phospho-proteomics, Cell Culture, Infection, Control, Knockdown

Journal: Translational Cancer Research

Article Title: Regulation of dynamin-related protein 1 (DRP1) levels modulates myoblast atrophy induced by C26 colon cancer-conditioned medium

doi: 10.21037/tcr-21-751

Figure Lengend Snippet: C26 CM reduced the marker of ribosomal biogenesis at mRNA levels. Gene expression levels of Pol-I, c-Myc, Ubf, Nop56, Ncl from C2C12 myotubes in KD/Dc/CM/HS groups using a real-time PCR method (n=4). Data were shown as mean ± SD. *P<0.05. HS, myotube cultured in DMEM of 2% HS (horse serum); CM, myotube cultured in DMEM of 33% C26 conditional medium; Dc, myotube infected with control lentivirus in C26 conditional medium; KD, myotube infected with knockdown lentivirus in C26 conditional medium; Pol-I, RNA polymerase I; c-Myc, MYC proto-oncogene; Ubf, upstream binding factor; Nop56, nucleolar protein 56; Ncl, nucleolin; PCR, polymerase chain reaction.

Article Snippet: C26 BALB/c mouse colon adenocarcinoma cells and C2C12 C3H mouse myoblasts (CRL-2638 and CRL1772, respectively; American Type Culture Collection, Manassas, VA, USA) were obtained from Dr. Han (Zhongshan Hospital, Shanghai, China).

Techniques: Marker, Gene Expression, Real-time Polymerase Chain Reaction, Cell Culture, Infection, Control, Knockdown, Binding Assay, Polymerase Chain Reaction